Instructions for downloading and installing the RBPBind software

The RBPBind software is meant for use under linux. It does not require any dependencies other than a valid build environment.

Download

Download the current version of the RBPBind software here.

Unpacking

Unpack the RBPbind software with

unzip RBPBind_1.0.0.zip

Compilation of the Vienna package

The RNA secondary structure calculations are performed via a modified version of the Vienna RNA package. In order to install the modified Vienna RNA package change into its main directory via

cd RBPBind_1.0.0/ViennaRNA-2.0.7_revised/

and follow the instructions in the INSTALL file found there. It is not necessary to perform the final make install step unless a system-wide installation is desired.

Compilation of RBPBind

Change to the server directory via

cd ../server

and compile the RBPBind software via

make

Example

To create data for the binding curve of the example case of the server use

./RBPBind proteinfiles/HuR.rnacompete UGUGAUGAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACAGA

To obtain the site occupancies for a free protein concentration of 4nM in this example use

./RBPBind -c 4 proteinfiles/HuR.rnacompete UGUGAUGAUUAUUUAUUAUUUAUUUAUUAUUUAUUUAUUUACAGA

If you make use of data generated on this server in your own publications, please do not forget to cite the manuscript:

Yi-Hsuan Lin, Jeffrey Gaither, and Ralf Bundschuh, RBPBind: Quantitative prediction of Protein-RNA Interactions

To download the source code underlying this server go here.

For questions and/or comments please send an email to ASC-bioserv@osu.edu.

This includes suggestions for new proteins to add, ideally accompanied by a reference for their RNACompete or RNA Bind-n-Seq data and one or a few references on independently determined absolute binding affinities for specific RNA molecules.